ArticleDetailDownload PDF

Artificial DNA/RNA synthesis is a groundbreaking engineering technique for designing and creating nucleic acid chains, which can lead to new genes to support many important applications, including gene therapy, the development of synthetic vaccines, and molecular engineering. The procedure is not without challenges, including the production of undesired shorter DNA/RNA sequences, and the formation of process-related impurities and by-products such as acrylonitrile and formaldehyde, which can generate sequence modifications called mutations. Dr Serge Beaucage and his research team at the US Food and Drug Administration have been working on improving the solid-phase synthesis and purification techniques (the procedures that allow for the manipulation and isolation of DNA and RNA after they are synthesised). They have developed three successful technologies to accomplish this.
Over the past few years, we have seen dramatic progress in artificial DNA synthesis capability (or DNA sequencing), together with advances in gene editing tools. Artificial DNA/RNA synthesis consists of a group of methods that are used in biology to design and assemble genes from oligonucleotides (the molecules that are their building blocks). Unlike DNA synthesis in living cells, artificial DNA synthesis does not require a template DNA, permitting virtually any DNA sequence to be synthesised in the laboratory.

The synthesis method that is primarily used these days is called phosphoramidite synthesis. This procedure has enabled the development of new and innovative treatments for long-term diseases including various cancer types, and also the development of new synthetic vaccines. All the procedures used to extract the desired DNA/RNA sequences after their assembly in the laboratory, however, have the disadvantage of being contaminated with by-products. Dr Serge Beaucage and his team as the US Food and Drug Administration developed three new methods to improve the solid-phase purification of DNA and RNA (the procedure that allows the manipulation and isolation of DNA and RNA using a single protocol). The first of these methods is the removal of shorter than full length DNA sequences from synthetic sequences; the second is the restriction of process-related impurities formation; and the third is the use of a novel 2’-O-hydroxyl protecting group to prevent the production of toxic by-products, including mutagenic formaldehyde and/or fluorine-containing contaminants, when traditional protecting groups (eg, acetals and/or silyl ethers) are used for the intended purpose.

ktsdesign/Shutterstock.com

Removal of shorter than full length DNA sequences

Despite the recent development of advanced methods for solid-phase DNA synthesis, little has been done so far to improve existing or to develop new procedures for the purification of synthetic nucleic acid sequences. The phosphoramidite method is quite efficient and can be scaled up for mass production, however the purification of DNA or RNA sequences presents a sizable challenge: the full-length nucleic acid sequences are mixed with shorter sequences, resulting from incomplete nucleotide assembly.

Other process-related impurities include deletion sequences secondary to failure of preventing the formation of shorter than full-length sequences, or of complete removal of the 5’-hydroxyl protecting group (a group of substances used to prevent formation of larger than full-length sequences) at each step of the DNA sequence assembly. Furthermore, formation of longer than full-length nucleic acid sequences can occur during solid-phase synthesis. These impurities could potentially elicit immune responses or adverse events if they are not removed before they are given to patients as nucleic acid-based drugs.

“They eventually demonstrated an up to 42% reduction of process-related impurities in synthetic nucleic acid sequences.”

The existing purification methods require high-capacity instruments and accessories and also large volumes of aqueous organic solvents. The team’s novel method, which is simpler and more cost-effective, consists of using aminopropylated silica gel with aminooxyalkyl functions as a support substance, to selectively capture the desired DNA chains, thereby allowing for removal of the shorter than full length DNA sequences. This is accomplished by incorporating a bifunctional linker (connecting) molecule into the DNA chain of interest to enable an oximation reaction (formation of an oxime from the reaction of the aminoalkyl function of the capture support with the ketone function of the bifunctional linker) while still being connected to the terminal hydroxyl of the desired DNA sequence.

After the shorter than full-length DNA sequences are washed off the capture support, the purified DNA sequences are released from their bond with the capture support by treatment with a specific chemical reagent. The purity of released DNA sequences exceeds 95%. Besides being very effective, the procedure is also scalable and appropriate for pharmaceutical production without sacrificing the purity of the DNA sequences.

Figure 1. a) Conceptual approach to the solid-phase purification of synthetic DNA sequences.
b) Solid-phase purification of the native DNA sequence: 5’-d (TCACTGTGAATCGATGCAATTGCACTGTGAATCGATGCCATCAC­TGTGAATCGATGCCAT).

Improved solid support to reduce impurities

Even though the chemical synthesis of DNA and RNA is a highly efficient procedure, the resulting product is still contaminated with process-related impurities. These impurities are shorter than full-length sequences that, as previously mentioned, could possibly cause adverse effects when administered as nucleic acid-based drugs. In an attempt to minimise the formation of those impurities to levels that will not become a safety concern, Beaucage’s research team decided to work on a new hypothesis, based on previous studies demonstrating that about 60% of all shorter than full-length DNA sequences were produced during the first five solid-phase synthesis cycles.

To alleviate the outcomes associated with the diffusion of reagents (substances added to a system to cause a chemical reaction, or to test if a reaction occurs) through a porous solid support medium (commercial controlled-pore glass, CPG) used for the procedure, the support medium was chemically modified so that the solid-phase synthesis process (with a solid as a medium) would behave like a solution-phase process (with a fluid as a medium).

To achieve this, the Beaucage research team modified a CPG support with the addition of multiple hexaethylene glycol spacers (flexible molecules that are used to link two molecules of interest together). By using the modified CPG support, the synthesis of DNA and RNA sequences was achieved with a significantly greater purity than that obtained from the current, state-of-the art, commercial long-chain alkylamine CPG (LCAA-CPG). The research team eventually demonstrated an up to 42% reduction of process-related impurities in synthetic nucleic acid sequences when using the modified CPG support instead of the LCAA-CPG. This lower content of residual impurities makes the purification process easier and can lead to the development of nucleic acid-based drugs of superior purity for safer and more efficacious therapeutic treatments.

Figure 2. a) Preparation of a CPG-derived support and its use toward the solid-phase synthesis of DNA and RNA sequences. Keys: CPG, controlled pore glass; DMTr, 4,4’-dimethoxytrityl; BP, N-protected nucleobase; R, H or OTBDMS, TBDMS, tert-butyldimethylsilyl
b) Expanded HPLC profiles of unpurified 5’-d(TCTTGGTTACATGAAATCCT), which was released from commercial LCAA-CPG (red profile) or hexaethylene glycol modified CPG support (blue profile) after complete deprotection. Peak heights of each profile were normalised to the highest peak, which was then set to 0.15 absorbance unit (AU) at 254nm.

Novel 2’-O-hydroxyl protecting groups

When compared to DNA synthesis, solid-phase RNA synthesis is a more complex procedure because of an additional part of the molecule called the 2’-hydroxyl of ribonucleosides. This additional 2’ hydroxyl (OH) group that is present in RNA, is highly important (being implicated in the biogenesis of life on Earth and related to how RNA chains should be stored to maintain stability) and therefore requires protection during and after RNA synthesis.

“This new method provides a viable approach to restricting the formation of impurities in synthetic RNA sequences.”

With the intent of achieving this, substances under the name of ribonucleoside-2’-O-protecting groups must be used to prevent RNA chain cleavage and to preserve the integrity of the RNA sequence. Because of these requirements, the search for an optimal 2’-hydroxyl-protecting group for RNA is of great importance. So far, in order to protect the 2’-hydroxyl, 2’-O-acetal-protecting groups of substances have been used. However, the 2’-O-acetal-protecting group has the disadvantage of generating formaldehyde during the mandatory deprotection process, which can cause mutations to RNA chains. Additionally, many of the currently used 2’-O-acetal-protecting groups require fluoride ions to be used for deprotection, leading to the generation of by-products, which need also be avoided to produce nucleic acid-based medications of the highest purity.

Figure 3. a) Schematic presentation of an innovative deprotection of 2’-O-Imino2-propanoate protecting group through an intramolecular decarboxylation process to otherwise avoid the production of mutagenic and/or fluorine/fluorides containing side products.
b) RP-HPLC profiles of (A) unpurified N-deacylated and phosphate deprotected r(U*A*U*C*C*G*U*A*G*C*U*A*A*C*G*U*C*A*G*T), where * represents the sodium salt of each de-esterified 2’-O-imino-2-propanoic acid ethyl ester function. (B) Unpurified, fully deprotected r(UAUCCGUAGCUAACGUCAGT). (C) Unpurified, fully deprotected r(UAUCCGUAGCUAACGUCAGT) synthesized from commercial 2’-O-TBDMS-ribonucleoside phosphoramidite monomers.

To tackle the above issues, Beaucage and his team designed and implemented a novel 2’-O-protecting group for ribonucleosides. They used a 2’-O-imino-2-propanoic acid ethyl ester with a similar synthetic strategy to the protecting substances previously used, following a chain of chemical reactions involving ribonucleoside phosphoramidites leading to solid-phase synthesis coupling efficiencies averaging 97% per coupling step, when compared to an average coupling efficiency of 96% when using commercial ribonucleosides phosphoramidites. A notable advantage of this 2’-O-protecting group relates to its cleavage from RNA sequences to provide the native RNA sequences. The 2’-O-deprotection process occurs through an intramolecular decarboxylative reaction leading to the production of volatile innocuous by-products, namely, carbon dioxide and acetonitrile. According to the team, this new method provides a viable approach to restricting the formation of impurities in synthetic RNA sequences and therefore to making RNA-based-drug treatments safer to patients. The only disadvantage of this method is that the ribonucleoside phosphoramidites harbouring the novel 2’-O-protecting group are not yet commercially available.

Improving solid-phase synthesis

The three studies outlined above led to the development of three distinct and important new methods for improving solid-phase DNA/RNA synthesis by using a CPG support bonded with five hexaethylene glycol spacers, an aminooxyalkylated silica gel to remove the shorter than full length DNA sequences, and a novel 2’-O-hydroxyl protecting group for RNA chains synthesis. These groundbreaking new techniques combined can provide a viable solution to minimising process-related impurities in synthetic DNA and RNA sequences and eventually make the treatment of human diseases with nucleic acid-based medications safer, more potent, and efficacious.

Christoph Burgstedt/Shutterstock.com
What are your near future research plans with regard to further improving the DNA/RNA solid-phase synthesis and purification process?
Current and future research plans include the development and implementation of thermolabile groups for the protection of hydroxyl, phosphate/thiophosphate and exocyclic amine functions of nucleosides and oligonucleotides so as to enable, when needed, a one-step thermolytic deprotection of all protecting groups from synthetic DNA/RNA sequences including release of these sequences from the synthesis support. Research is also being conducted to automate the solid-phase synthesis and solid-phase purification of nucleic acids before undertaking the development of a continuous manufacturing process for the production of nucleic acid based-drugs, intended for the treatment of human diseases under antisense and/or RNA interference therapies.

 

References

  • Takahashi, M, et al (2021) Innovative 2-O-Imino-2-propanoate-Protecting Group for Effective Solid-Phase Synthesis and 2-O-Deprotection of RNA Sequences. The Journal of Organic Chemistry, 86, 4944−4956. doi.org/10.1021/acs.joc.0c02773
  • Grajkowski, A, et al, (2020) An expedient process for reducing the formation of process-related impurities during solid-phase synthesis of potential nucleic acid-based drugs. Bioorganic & Medicinal Chemistry, 28, 115779. doi.org/10.1016/j.bmc.2020.115779
  • Grajkowski, A, et al, (2016) Solid-Phase Purification of Synthetic DNA Sequences. The Journal of Organic Chemistry, 81, 6165−6175. doi.org/10.1021/acs.joc.6b01020
DOI
10.26904/RF-140-2321168508

Research Objectives

Dr Serge Beaucage and his research team are working to improve solid-phase synthesis and purification of synthetic DNA and RNA sequences.

Funding

This work is supported by FDA intramural funds and in part by the appointment of a postdoctoral fellow to the Postgraduate Research Participation Program at the Center for Drug Evaluation and Research, administered by the Oak Ridge Institute for Science and Education through an interagency agreement between the US Department of Energy and the US Food and Drug Administration.

Collaborators

Andrzej Grajkowski, Mayumi Takahashi, Brian M Cawrse, Jacek Cieslak, Sivakoteswara Rao Mandadapu.

Bio

Serge L Beaucage was awarded a doctoral degree in chemistry from McGill University in 1979. He then performed postdoctoral studies at the University of Colorado, Boulder, where he developed and co-invented in 1981 the use of deoxyribonucleoside phosphoramidites for solid-phase synthesis of DNA sequences. After completing postdoctoral studies at Stanford University School of Medicine, Beaucage joined the FDA in 1988, where his research interests are still aimed at developing chemical methods to improve the quality of synthetic nucleic acid sequences for potential therapeutic applications as nucleic acid-based drugs.

…

Contact

E: serge.beaucage@fda.hhs.gov
E: beaucage.serge@gmail.com
T: +1 240 402 9387